miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-767-5p | ||||
miRNA Stemloop AC | MI0003763 | ||||
miRNA Stemloop ID | hsa-mir-767 | ||||
Sequence | ugcaccaugguugucugagcaug | ||||
TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [1] | |
Platelet-derived growth factor receptor beta (PDGFRB) | Successful Target | Target Info | [1] | ||
Lysyl oxidase (LOX) | Literature-reported Target | Target Info | [1] | ||
Osteonectin (SPARC) | Literature-reported Target | Target Info | [1] | ||
Protein(s) Regulated by This miRNA | Collagen alpha-1(III) chain | Regulated Protein | [1] | ||
Collagen alpha-1(IV) chain | Regulated Protein | [1] | |||
Collagen alpha-1(X) chain | Regulated Protein | [1] | |||
Collagen alpha-2(IV) chain | Regulated Protein | [1] | |||
Collagen alpha-2(V) chain | Regulated Protein | [1] | |||
Fibrillin-1 | Regulated Protein | [1] | |||
Serpin H1 | Regulated Protein | [1] | |||
References | |||||
REF 1 | A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14. | ||||
REF 2 | A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.