miRNA General Information
miRNA Mature ID hsa-miR-767-5p
miRNA Stemloop AC MI0003763
miRNA Stemloop ID hsa-mir-767
Sequence ugcaccaugguugucugagcaug
TTD Target(s) Regulated by This miRNA Matrix metalloproteinase-2 (MMP-2) Successful Target Target Info [1]
Platelet-derived growth factor receptor beta (PDGFRB) Successful Target Target Info [1]
Lysyl oxidase (LOX) Literature-reported Target Target Info [1]
Osteonectin (SPARC) Literature-reported Target Target Info [1]
Protein(s) Regulated by This miRNA Collagen alpha-1(III) chain Regulated Protein [1]
Collagen alpha-1(IV) chain Regulated Protein [1]
Collagen alpha-1(X) chain Regulated Protein [1]
Collagen alpha-2(IV) chain Regulated Protein [1]
Collagen alpha-2(V) chain Regulated Protein [1]
Fibrillin-1 Regulated Protein [1]
Serpin H1 Regulated Protein [1]
References
REF 1 A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14.
REF 2 A miRNA-regulatory network explains how dysregulated miRNAs perturb oncogenic processes across diverse cancers. Genome Res. 2012 Nov;22(11):2302-14.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.