miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-637 | ||||
| miRNA Stemloop AC | MI0003652 | ||||
| miRNA Stemloop ID | hsa-mir-637 | ||||
| Sequence | acugggggcuuucgggcucugcgu | ||||
| TTD Target(s) Regulated by This miRNA | RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Collagen alpha-1(IV) chain | Regulated Protein | [2] | ||
| Transcription factor Sp7 | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | Decreased miRNA-637 is an unfavorable prognosis marker and promotes glioma cell growth, migration and invasion via direct targeting Akt1. Oncogene. 2015 Sep 17;34(38):4952-63. | ||||
| REF 2 | Vitamin D activation of functionally distinct regulatory miRNAs in primary human osteoblasts. J Bone Miner Res. 2013 Jun;28(6):1478-88. | ||||
| REF 3 | MiR-637 maintains the balance between adipocytes and osteoblasts by directly targeting Osterix.Mol Biol Cell. 2011 Nov;22(21):3955-61. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.