miRNA General Information
miRNA Mature ID	hsa-miR-4689
miRNA Stemloop AC	MI0017322
miRNA Stemloop ID	hsa-mir-4689
Sequence	uugaggagacauggugggggcc
TTD Target(s) Regulated by This miRNA	RAC-alpha serine/threonine-protein kinase (AKT1)	Successful Target	Target Info	[1]
References
REF 1	Concurrent Targeting of KRAS and AKT by MiR-4689 Is a Novel Treatment Against Mutant KRAS Colorectal Cancer. Mol Ther Nucleic Acids. 2015 Mar 10;4:e231.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.