miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-374b-5p | ||||
| miRNA Stemloop AC | MI0005566 | ||||
| miRNA Stemloop ID | hsa-mir-374b | ||||
| Sequence | auauaauacaaccugcuaagug | ||||
| TTD Target(s) Regulated by This miRNA | Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [1] | |
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [2] | ||
| Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Protein Wnt-16 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8. | ||||
| REF 2 | MicroRNA-374b Suppresses Proliferation and Promotes Apoptosis in T-cell Lymphoblastic Lymphoma by Repressing AKT1 and Wnt-16. Clin Cancer Res. 2015 Nov 1;21(21):4881-91. | ||||
| REF 3 | MiR-374b-5p suppresses RECK expression and promotes gastric cancer cell invasion and metastasis. World J Gastroenterol. 2014 Dec 14;20(46):17439-47. | ||||
| REF 4 | MicroRNA-374b Suppresses Proliferation and Promotes Apoptosis in T-cell Lymphoblastic Lymphoma by Repressing AKT1 and Wnt-16. Clin Cancer Res. 2015 Nov 1;21(21):4881-91. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.