miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-24-2-5p | ||||
| miRNA Stemloop AC | MI0000081 | ||||
| miRNA Stemloop ID | hsa-mir-24-2 | ||||
| Sequence | ugccuacugagcugaaacacag | ||||
| TTD Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Protein sprouty homolog 2 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miR-24-2 controls H2AFX expression regardless of gene copy number alteration and induces apoptosis by targeting antiapoptotic gene BCL-2: a potential for therapeutic intervention. Breast Cancer Res. 2011 Apr 4;13(2):R39. | ||||
| REF 2 | c-MYC-regulated miR-23a/24-2/27a cluster promotes mammary carcinoma cell invasion and hepatic metastasis by targeting Sprouty2.J Biol Chem. 2013 Jun 21;288(25):18121-33. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.