Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T97766 |
Target Info
|
| Target Name |
Leukocyte surface antigen CD47 (CD47) |
| Synonyms |
Protein MER6; MER6; Integrinassociated protein; Integrin-associated protein; IAP; Antigenic surface determinant protein OA3 |
| Target Type |
Clinical trial Target |
| Gene Name |
CD47 |
| Biochemical Class |
Osteoclast fusion complex |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-192-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cugaccuaugaauugacagcc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-192 decreased cellular anchoring via the repression of CD47. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Activated leukocyte cell adhesionmolecule (ALCAM)
|
Target Info
|
|
|
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-192 suppresses leptomeningeal dissemination of medulloblastoma by modulating cell proliferation and anchoring through the regulation of DHFR, integrins, and CD47. Oncotarget. 2015 Dec 22;6(41):43712-30.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
