Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T97135 Target Info
Target Name Nestin (NES)
Synonyms Nbla00170
Target Type Literature-reported Target
Gene Name NES
UniProt ID
P48681
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-432-5p miRNA Info
miRNA Mature AC
MIMAT0002814
Sequence ucuuggaguaggucauugggugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Methyl cpg binding protein 2 (MECP2) Target Info
MECP2_HUMAN
Nestin (NES) Target Info
NEST_HUMAN
miRNA Mature ID hsa-miR-487b-5p miRNA Info
miRNA Mature AC
MIMAT0026614
Sequence gugguuaucccuguccuguucg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-487b in a pediatric glioma cell line (KNS42) using lentiviral vectors led to a decrease in colony formation in soft agar and decreased expression of target Nestin. [2]
Evidence Score (E-score) 1 +
1 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Nestin (NES) Target Info
NEST_HUMAN
Prominin-1 (PROM1) Target Info
PROM1_HUMAN
References  Top
REF 1 MicroRNA-432 contributes to dopamine cocktail and retinoic acid induced differentiation of human neuroblastoma cells by targeting NESTIN and RCOR1 genes. FEBS Lett. 2014 May 2;588(9):1706-14.
REF 2 MicroRNA profiling of low-grade glial and glioneuronal tumors shows an independent role for cluster 14q32.31 member miR-487b. Mod Pathol. 2017 Feb;30(2):204-216.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.