Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T96627 |
Target Info
|
| Target Name |
C-X-C motif chemokine 2 (CXCL2) |
| Synonyms |
SCYB2; Macrophage inflammatory protein 2-alpha; MIP2A; MIP2-alpha; Growth-regulated protein beta; Growth regulatedprotein beta; Gro-beta; GROB; GRO2 |
| Target Type |
Clinical trial Target |
| Gene Name |
CXCL2 |
| Biochemical Class |
Cytokine: CXC chemokine |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-223-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugucaguuugucaaauacccca
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-223 directly targets the chemoattractants CXCL2. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
ATM serine/threonine kinase (ATM)
|
Target Info
|
|
|
C-X-C motif chemokine 2 (CXCL2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-532-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
caugccuugaguguaggaccgu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[3] |
| Representative Target(s) Regulated by This miRNA |
C-X-C motif chemokine 2 (CXCL2)
|
Target Info
|
|
|
Fatty acid synthase (FASN)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-223 controls susceptibility to tuberculosis by regulating lung neutrophil recruitment. J Clin Invest. 2013 Nov;123(11):4836-48.
|
| REF 2 |
MicroRNA 223 3p Negatively Regulates the NLRP3 Inflammasome in Acute and Chronic Liver Injury. Mol Ther. 2019 Sep 13. pii: S1525-0016(19)30416-2.
|
| REF 3 |
Loss of miR-532-5p in vitro promotes cell proliferation and metastasis by influencing CXCL2 expression in HCC. Am J Transl Res. 2015 Nov 15;7(11):2254-61.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
