Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T93830 Target Info
Target Name Granulin (GRN)
Synonyms Progranulin (58-573); Proepithelin (58-573); PGRN (58-573); PEPI (58-573); PCDGF (58-573); PC cell-derived growth factor (58-573); Granulin-epithelin; Granulin precursor (58-573); Glycoprotein of 88 Kda (58-573); Glycoprotein 88 (58-573); GP88 (58-573); Epithelin precursor (58-573); Acrogranin (58-573)
Target Type Literature-reported Target
Gene Name GRN
UniProt ID
P28799 (58 - 573)
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism miR-107 gene group can regulate GRN expression and that the GRN expression is exerted through the 5' seed sequence of the miRNAs. [2]
Evidence Score (E-score) 2 +
1 Microarray; Western Blot [1]
2 Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-659-3p miRNA Info
miRNA Mature AC
MIMAT0003337
Sequence cuugguucagggagggucccca
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-659-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target GRN. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Granulin (GRN) Target Info
GRN_HUMAN
Sphingosine kinase 1 (SPHK1) Target Info
SPHK1_HUMAN
miRNA Mature ID hsa-miR-588 miRNA Info
miRNA Mature AC
MIMAT0003255
Sequence uuggccacaauggguuagaac
miRNA Species Homo sapiens
Regulation Mechanism Expression of GRN was regulated by miR-588. [4]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Granulin (GRN) Target Info
GRN_HUMAN
References  Top
REF 1 Dysregulation of the mitogen granulin in human cancer through the miR-15/107 microRNA gene group. Cancer Res. 2010 Nov 15;70(22):9137-42.
REF 2 miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease. Am J Pathol. 2010 Jul;177(1):334-45.
REF 3 Common variation in the miR-659 binding-site of GRN is a major risk factor for TDP43-positive frontotemporal dementia. Hum Mol Genet. 2008 Dec 1;17(23):3631-42.
REF 4 MicroRNA-588 suppresses tumor cell migration and invasion by targeting GRN in lung squamous cell carcinoma. Mol Med Rep. 2016 Oct;14(4):3021-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.