Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T93105 Target Info
Target Name Presenilin 1 (PSEN1)
Synonyms S182 protein; Protein S182; Presenilin-1; PSNL1; PS1; PS-1; AD3
Target Type Clinical trial Target
Gene Name PSEN1
Biochemical Class Peptidase
UniProt ID
P49768
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-562 miRNA Info
miRNA Mature AC
MIMAT0003226
Sequence aaaguagcuguaccauuugc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Presenilin 1 (PSEN1) Target Info
PSN1_HUMAN
Proto-oncogene c-Met (MET) Target Info
MET_HUMAN
References  Top
REF 1 Loss of heterozygosity at 2q37 in sporadic Wilms' tumor: putative role for miR-562. Clin Cancer Res. 2009 Oct 1;15(19):5985-92.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.