Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T92144 |
Target Info
|
| Target Name |
Angiopoietin 1 receptor (TEK) |
| Synonyms |
hTIE2; VMCM1; VMCM; Tyrosine-protein kinase receptor TIE-2; Tyrosine-protein kinase receptor TEK; Tyrosine kinase with Ig and EGF homology domains-2; Tunica interna endothelial cell kinase; TIE2; P140 TEK; Endothelial tyrosine kinase; Endothelial Cell-Specific Receptor TIE-2; CD202b antigen; CD202b |
| Target Type |
Clinical trial Target |
| Gene Name |
TEK |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-126-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucguaccgugaguaauaaugcg
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-126 to specifically target Tie-2. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Literature Reported |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Adrenomedullin (ADM)
|
Target Info
|
|
|
Angiopoietin 1 receptor (TEK)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Angiogenic Mechanisms of Human CD34+ Stem Cell Exosomes in the Repair of Ischemic Hindlimb. Circ Res. 2017 Apr 28;120(9):1466-1476.
|
| REF 2 |
The miR-126 regulates angiopoietin-1 signaling and vessel maturation by targeting p85. Biochim Biophys Acta. 2012 Oct;1823(10):1925-35.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
