Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T92042 Target Info
Target Name GDNF receptor alpha-3 (GFRA3)
Synonyms UNQ339/PRO538/PRO3664; GFR-alpha-3; GDNFR-alpha-3; GDNF family receptor alpha-3
Target Type Clinical trial Target
Gene Name GFRA3
UniProt ID
O60609
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism GFRA3 was found to be directly regulated by miR-34a via its coding region. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
References  Top
REF 1 Identification of targets of tumor suppressor microRNA-34a using a reporter library system. Proc Natl Acad Sci U S A. 2017 Apr 11;114(15):3927-3932.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.