Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T89360 Target Info
Target Name Inosine-5'-monophosphate dehydrogenase 2 (IMPDH2)
Synonyms IMPDH-II; IMPDH 2; IMPD2; IMPD 2; IMP dehydrogenase 2
Target Type Successful Target
Gene Name IMPDH2
Biochemical Class CH-OH donor oxidoreductase
UniProt ID
P12268
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism miR-34a directly targets IMPDH2 through a CDS-located miR-34a-binding site. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
References  Top
REF 1 A p53-inducible microRNA-34a downregulates Ras signaling by targeting IMPDH. Biochem Biophys Res Commun. 2012 Feb 24;418(4):682-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.