Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T87981 |
Target Info
|
| Target Name |
IL-1 receptor-associated kinase 3 (IRAK3) |
| Synonyms |
Interleukin-1 receptor-associated kinase 3; IRAK-M; IRAK-3; IL-1 receptor-associated kinase M |
| Target Type |
Literature-reported Target |
| Gene Name |
IRAK3 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-155-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cuccuacauauuagcauuaaca
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Literature Reported |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
|
Erbb2 tyrosine kinase receptor (HER2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-155-at the Critical Interface of Innate and Adaptive Immunity in Arthritis. Front Immunol. 2018 Jan 5;8:1932.
|
| REF 2 |
miR-155 and its star-form partner miR-155* cooperatively regulate type I interferon production by human plasmacytoid dendritic cells. Blood. 2010 Dec 23;116(26):5885-94.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
