Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T87670 Target Info
Target Name G-protein coupled receptor 55 (GPR55)
Synonyms LPIR1
Target Type Successful Target
Gene Name GPR55
Biochemical Class GPCR rhodopsin
UniProt ID
Q9Y2T6
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-675-5p miRNA Info
miRNA Mature AC
MIMAT0004284
Sequence uggugcggagagggcccacagug
miRNA Species Homo sapiens
Regulation Mechanism GPR55 is a direct downstream target of miR-675-5p. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA G-protein coupled receptor 55 (GPR55) Target Info
GPR55_HUMAN
Histone deacetylase 4 (HDAC4) Target Info
HDAC4_HUMAN
References  Top
REF 1 Down-regulation of miR-675-5p contributes to tumor progression and development by targeting pro-tumorigenic GPR55 in non-small cell lung cancer. Mol Cancer. 2015 Apr 1;14:73.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.