Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T87448 Target Info
Target Name Nodal homolog (NODAL)
Synonyms nodal growth differentiation factor; HTX5
Target Type Literature-reported Target
Gene Name NODAL
Biochemical Class Growth factor
UniProt ID
Q96S42
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-378a-5p miRNA Info
miRNA Mature AC
MIMAT0000731
Sequence cuccugacuccagguccugugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Nodal homolog (NODAL) Target Info
NODAL_HUMAN
Tumor suppressor candidate 2 (TUSC2) Target Info
TUSC2_HUMAN
References  Top
REF 1 MicroRNA-378a-5p promotes trophoblast cell survival, migration and invasion by targeting Nodal. J Cell Sci. 2012 Jul 1;125(Pt 13):3124-32.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.