Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T86254 |
Target Info
|
| Target Name |
Tenascin (TNC) |
| Synonyms |
Tenascin-C; TN-C; TN; Neuronectin; Myotendinous antigen; Miotendinous antigen; JI; Hexabrachion; HXB; Glioma-associated-extracellular matrix antigen; GP 150-225; GMEM; Cytotactin |
| Target Type |
Clinical trial Target |
| Gene Name |
TNC |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-335-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucaagagcaauaacgaaaaaugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
TNC was the direct target of miR-335. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; Microarray; Microarray |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
|
| REF 2 |
miR-335 and miR-363 regulation of neuroblastoma tumorigenesis and metastasis. Surgery. 2013 Aug;154(2):226-33.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
