Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T83875 Target Info
Target Name Monoamine oxidase type A (MAO-A)
Synonyms Monoamine oxidase A; Amine oxidase [flavin-containing] A
Target Type Successful Target
Gene Name MAOA
Biochemical Class CH-NH(2) donor oxidoreductase
UniProt ID
P21397
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism The regulator of MAOA was potentially repressed by miR-22. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
References  Top
REF 1 Human microRNAs miR-22, miR-138-2, miR-148a, and miR-488 are associated with panic disorder and regulate several anxiety candidate genes and related pathways. Biol Psychiatry. 2011 Mar 15;69(6):526-33.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.