Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T78492 |
Target Info
|
| Target Name |
MAPK/ERK kinase kinase 4 (MAP3K4) |
| Synonyms |
Mitogen-activated protein kinase kinase kinase 4; MTK1; MEKK4; MEKK 4; MEK kinase 4; MAPKKK4; MAP three kinase 1; KIAA0213 |
| Target Type |
Literature-reported Target |
| Gene Name |
MAP3K4 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-148a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucagugcacuacagaacuuugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-148a negatively regulates MAP3K4 vitro and in vivo. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Activated leukocyte cell adhesionmolecule (ALCAM)
|
Target Info
|
|
|
Activin receptor-like kinase 2 (ALK-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Role of miR-148a in cutaneous squamous cell carcinoma by repression of MAPK pathway. Arch Biochem Biophys. 2015 Oct 1;583:47-54.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
