Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T77410 Target Info
Target Name Bone morphogenetic protein 4 (BMP4)
Synonyms DVR4; Bone morphogenetic protein 2B; BMP2B; BMP-4; BMP-2B
Target Type Literature-reported Target
Gene Name BMP4
Biochemical Class Growth factor
UniProt ID
P12644
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-let-7i-5p miRNA Info
miRNA Mature AC
MIMAT0000415
Sequence ugagguaguaguuugugcuguu
miRNA Species Homo sapiens
Regulation Mechanism Bone morphogenetic protein 4 (BMP4) as a candidate target of let-7i. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
Bone morphogenetic protein 4 (BMP4) Target Info
BMP4_HUMAN
References  Top
REF 1 Repression of bone morphogenetic protein 4 by let-7i attenuates mesenchymal migration of head and neck cancer cells. Biochem Biophys Res Commun. 2013 Mar 29;433(1):24-30.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.