Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T77139 |
Target Info
|
| Target Name |
MAPK/ERK kinase kinase 3 (MAP3K3) |
| Synonyms |
Mitogen-activated protein kinase kinase kinase 3; MEKK3; MEKK 3; MEK kinase 3; MAPKKK3 |
| Target Type |
Literature-reported Target |
| Gene Name |
MAP3K3 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-122-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggagugugacaaugguguuug
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
|
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Liver-enriched transcription factors regulate microRNA-122 that targets CUTL1 during liver development. Hepatology. 2010 Oct;52(4):1431-42.
|
| REF 2 |
microRNA-122 regulates hypoxia-inducible factor-1 and vimentin in hepatocytes and correlates with fibrosis in diet-induced steatohepatitis. Liver Int. 2015 Feb;35(2):532-41.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
