Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T76937 Target Info
Target Name Voltage-gated sodium channel alpha Nav1.3 (SCN3A)
Synonyms Voltage-gated sodium channel subunit alpha Nav1.3; Voltage-gated sodium channel subtype III; Sodium channel protein, brain III subunit alpha; Sodium channel protein type III subunit alpha; Sodium channel protein type 3 subunit alpha; Sodium channel protein brain III subunit alpha; NAC3; KIAA1356
Target Type Successful Target
Gene Name SCN3A
Biochemical Class Voltage-gated ion channel
UniProt ID
Q9NY46
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-877-5p miRNA Info
miRNA Mature AC
MIMAT0004949
Sequence guagaggagauggcgcaggg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Voltage-gated sodium channel alpha Nav1.3 (SCN3A) Target Info
SCN3A_HUMAN
References  Top
REF 1 The biogenesis and characterization of mammalian microRNAs of mirtron origin. Nucleic Acids Res. 2012 Jan;40(1):438-48.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.