Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T73075 |
Target Info
|
| Target Name |
Perlecan (HSPG) |
| Synonyms |
LG3 peptide; Basement membranespecific heparan sulfate proteoglycan coreprotein; Basement membrane-specific heparan sulfate proteoglycan core protein |
| Target Type |
Discontinued Target |
| Gene Name |
HSPG2 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-663a |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aggcggggcgccgcgggaccgc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-663 Regulates the Chemosensitivity of Human Breast Cancer Cells by Targeting HSPG2. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
C-X-C chemokine receptor type 4 (CXCR4)
|
Target Info
|
|
|
CCAAT/enhancer binding protein beta (CEBPB)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The overexpression of hypomethylated miR-663 induces chemotherapy resistance in human breast cancer cells by targeting heparin sulfate proteoglycan 2 (HSPG2). J Biol Chem. 2013 Apr 19;288(16):10973-85.
|
| REF 2 |
MiR-663, a MicroRNA Linked with Inflammation and Cancer That Is under the Influence of Resveratrol. Medicines (Basel). 2018 Jul 9;5(3). pii: E74.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
