Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T72515 Target Info
Target Name Interleukin 1 receptor type 1 (IL1R1)
Synonyms p80; Interleukin-1 receptor type I; Interleukin-1 receptor type 1; Interleukin-1 receptor alpha; IL1RT1; IL1RA; IL1R; IL-1RT1; IL-1RT-1; IL-1R-alpha; IL-1R-1; CD121a; CD121 antigen-like family member A
Target Type Successful Target
Gene Name IL1R1
Biochemical Class Cytokine receptor
UniProt ID
P14778
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-181d-3p miRNA Info
miRNA Mature AC
MIMAT0026608
Sequence ccaccgggggaugaaugucac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [1]
Representative Target(s) Regulated by This miRNA C-C chemokine receptor type 1 (CCR1) Target Info
CCR1_HUMAN
Interleukin 1 receptor type 1 (IL1R1) Target Info
IL1R1_HUMAN
References  Top
REF 1 Identification of IGF-1-enhanced cytokine expressions targeted by miR-181d in glioblastomas via an integrative miRNA/mRNA regulatory network analysis. Sci Rep. 2017 Apr 7;7(1):732.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.