Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T71317 Target Info
Target Name AP-2 transcription factor (TFAP2A)
Synonyms Transcription factor AP-2-alpha; TFAP2; Activator protein 2; Activating enhancer-binding protein 2-alpha; AP2TF; AP2-alpha; AP-2
Target Type Literature-reported Target
Gene Name TFAP2A
UniProt ID
P05549
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-193a-5p miRNA Info
miRNA Mature AC
MIMAT0004614
Sequence ugggucuuugcgggcgagauga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA AP-2 transcription factor (TFAP2A) Target Info
AP2A_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
References  Top
REF 1 MiR-193a-5p Targets the Coding Region of AP-2 mRNA and Induces Cisplatin Resistance in Bladder Cancers. J Cancer. 2016 Aug 7;7(12):1740-1746.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.