Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T71086 |
Target Info
|
| Target Name |
Complement factor H (CFH) |
| Synonyms |
HF2; HF1; HF; H factor 1 |
| Target Type |
Clinical trial Target |
| Gene Name |
CFH |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-146a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugagaacugaauuccauggguu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The NF-kB-sensitive miRNA-146a acts as a repressor of its CFH mRNA target. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Activation B7-1 antigen (CD80)
|
Target Info
|
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Characterization of an NF-kappaB-regulated, miRNA-146a-mediated down-regulation of complement factor H (CFH) in metal-sulfate-stressed human brain cells. J Inorg Biochem. 2009 Nov;103(11):1591-5.
|
| REF 2 |
An NF-kappaB-sensitive micro RNA-146a-mediated inflammatory circuit in Alzheimer disease and in stressed human brain cells. J Biol Chem. 2008 Nov 14;283(46):31315-22.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
