Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T65483 Target Info
Target Name Carboxypeptidase M (CPM)
Synonyms Human carboxypeptidase M
Target Type Literature-reported Target
Gene Name CPM
Biochemical Class Peptidase
UniProt ID
P14384
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-146a-5p binds to CPM 3'UTR. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
References  Top
REF 1 MicroRNA-146a promote cell migration and invasion in human colorectal cancer via carboxypeptidase M/src-FAK pathway. Oncotarget. 2017 Apr 4;8(14):22674-22684.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.