Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T63220 Target Info
Target Name Activated CDC42 kinase 1 (ACK-1)
Synonyms Tyrosine kinase non-receptor protein 2; ACK1; ACK-1
Target Type Patented-recorded Target
Gene Name TNK2
Biochemical Class Kinase
UniProt ID
Q07912
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-7-5p miRNA Info
miRNA Mature AC
MIMAT0000252
Sequence uggaagacuagugauuuuguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-7-5p by mature miRNA precursor transfection resulted in the decreased protein level of target TNK2. [1]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Activated CDC42 kinase 1 (ACK-1) Target Info
ACK1_HUMAN
Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
References  Top
REF 1 miRNA-7 attenuation in Schwannoma tumors stimulates growth by upregulating three oncogenic signaling pathways. Cancer Res. 2011 Feb 1;71(3):852-61.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.