Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T63068 Target Info
Target Name Serum albumin (ALB)
Synonyms Serum albumin
Target Type Successful Target
Gene Name ALB
UniProt ID
P02768
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-492 miRNA Info
miRNA Mature AC
MIMAT0002812
Sequence aggaccugcgggacaagauucuu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Microarray [1]
Representative Target(s) Regulated by This miRNA Basigin (BSG) Target Info
BASI_HUMAN
Multiple tumor suppressor 1 (CDKN2A) Target Info
CDN2A_HUMAN
References  Top
REF 1 MicroRNA-492 is processed from the keratin 19 gene and up-regulated in metastatic hepatoblastoma. Hepatology. 2011 Mar;53(3):833-42.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.