Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T55781 |
Target Info
|
Target Name |
Tyrosine-protein kinase Mer (MERTK) |
Synonyms |
Receptor tyrosine kinase MerTK; Proto-oncogene c-Mer |
Target Type |
Clinical trial Target |
Gene Name |
MERTK |
Biochemical Class |
Kinase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-126-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucguaccgugaguaauaaugcg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-126 directly targets gene MERTK. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Dual Luciferase Reporter Assay |
[1] |
2 |
ELISA; Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Adrenomedullin (ADM)
|
Target Info
|
|
Angiopoietin 1 receptor (TEK)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-335-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucaagagcaauaacgaaaaaugu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
References |
Top |
REF 1 |
MicroRNA-126 overexpression rescues diabetes-induced impairment in efferocytosis of apoptotic cardiomyocytes. Sci Rep. 2016 Nov 9;6:36207.
|
REF 2 |
A microRNA regulon that mediates endothelial recruitment and metastasis by cancer cells. Nature. 2011 Dec 14;481(7380):190-4.
|
REF 3 |
Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.