Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T53975 Target Info
Target Name C-X-C chemokine receptor type 6 (CXCR6)
Synonyms TYMSTR; STRL33; G-protein coupled receptor bonzo; G-protein coupled receptor STRL33; G protein-coupled receptor bonzo; G protein-coupled receptor STRL33; Chemokine receptor CXCR6; CXCR-6; CXC-R6; CDw186; CD186; BONZO
Target Type Literature-reported Target
Gene Name CXCR6
Biochemical Class GPCR rhodopsin
UniProt ID
O00574
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-361-5p miRNA Info
miRNA Mature AC
MIMAT0000703
Sequence uuaucagaaucuccagggguac
miRNA Species Homo sapiens
Regulation Mechanism CXCR6 was identified as a target of miR-361-5p. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 6 (CXCR6) Target Info
CXCR6_HUMAN
Signal transducer and activator of transcription 6 (STAT6) Target Info
STAT6_HUMAN
References  Top
REF 1 MicroRNA-361-5p Inhibits Cancer Cell Growth by Targeting CXCR6 in Hepatocellular Carcinoma. Cell Physiol Biochem. 2016;38(2):777-85.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.