Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T51693 Target Info
Target Name Melanoma-associated antigen 3 (MAGEA3)
Synonyms Melanoma associated antigen-A3; Melanoma antigen 3; MAGE3; MAGE-A3 antigen; MAGE-A3; MAGE-3 antigen; Cancer/testis antigen 1.3; CT1.3; Antigen MZ2-D
Target Type Clinical trial Target
Gene Name MAGEA3
Biochemical Class Melanoma associated antigen
UniProt ID
P43357
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism MAGE-A3 is a direct target for miR-34a. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
References  Top
REF 1 miR-34a confers chemosensitivity through modulation of MAGE-A and p53 in medulloblastoma. Neuro Oncol. 2011 Feb;13(2):165-75.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.