Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T51569 Target Info
Target Name Cell surface glycoprotein MUC18 (MCAM)
Synonyms S-endo 1 endothelial-associated antigen; Melanoma-associated antigen MUC18; Melanoma-associated antigen A32; Melanoma cell adhesion molecule; Melanoma adhesion molecule; MUC18; Cell surface glycoprotein P1H12; CD146 antigen; CD146
Target Type Literature-reported Target
Gene Name MCAM
UniProt ID
P43121
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-573 miRNA Info
miRNA Mature AC
MIMAT0003238
Sequence cugaagugauguguaacugaucag
miRNA Species Homo sapiens
Regulation Mechanism miR-573 directly regulates the expression of MCAM. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Cell surface glycoprotein MUC18 (MCAM) Target Info
MUC18_HUMAN
Fibroblast growth factor receptor 1 (FGFR1) Target Info
FGFR1_HUMAN
References  Top
REF 1 miR-573 regulates melanoma progression by targeting the melanoma cell adhesion molecule. Oncol Rep. 2013 Jul;30(1):520-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.