Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T51565 Target Info
Target Name Casein kinase II alpha (CSNK2A1)
Synonyms Protein kinase CK2; Casein kinase II subunit alpha; CK2A1; CK II alpha; CK II
Target Type Clinical trial Target
Gene Name CSNK2A1
Biochemical Class Kinase
UniProt ID
P68400
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-186-5p miRNA Info
miRNA Mature AC
MIMAT0000456
Sequence caaagaauucuccuuuugggcu
miRNA Species Homo sapiens
Regulation Mechanism miR-186 induces cellular senescence by targeting a subunit of protein kinase CKII in human colorectal cancer cells. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
miRNA Mature ID hsa-miR-216b-5p miRNA Info
miRNA Mature AC
MIMAT0004959
Sequence aaaucucugcaggcaaauguga
miRNA Species Homo sapiens
Regulation Mechanism miR-216b induces cellular senescence by targeting a subunit of protein kinase CKII in human colorectal cancer cells. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
miRNA Mature ID hsa-miR-337-3p miRNA Info
miRNA Mature AC
MIMAT0000754
Sequence cuccuauaugaugccuuucuuc
miRNA Species Homo sapiens
Regulation Mechanism miR-337-3p induces cellular senescence by targeting a subunit of protein kinase CKII in human colorectal cancer cells. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
Signal transducer and activator of transcription 3 (STAT3) Target Info
STAT3_HUMAN
miRNA Mature ID hsa-miR-760 miRNA Info
miRNA Mature AC
MIMAT0004957
Sequence cggcucugggucugugggga
miRNA Species Homo sapiens
Regulation Mechanism miR-760 induces cellular senescence by targeting a subunit of protein kinase CKII in human colorectal cancer cells. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
References  Top
REF 1 MiR-186, miR-216b, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting subunit of protein kinase CKII in human colorectal cancer cells. Biochem Biophys Res Commun. 2012 Dec 14;429(3-4):173-9.
REF 2 Upregulation of miR-760 and miR-186 is associated with replicative senescence in human lung fibroblast cells. Mol Cells. 2014 Aug;37(8):620-7.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.