Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T51426 Target Info
Target Name Farnesoid X-activated receptor (FXR)
Synonyms Retinoid X receptor-interacting protein 14; RXR-interacting protein 14; RIP14; Nuclear receptor subfamily 1 group H member 4; HRR1; Farnesol receptor HRR-1; FXR; Bile acid receptor; BAR
Target Type Successful Target
Gene Name NR1H4
Biochemical Class Nuclear hormone receptor
UniProt ID
Q96RI1
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-192-3p miRNA Info
miRNA Mature AC
MIMAT0004543
Sequence cugccaauuccauaggucacag
miRNA Species Homo sapiens
Regulation Mechanism miR-192-3p bound specifically to the NR1H4- 3'UTR and decreased luciferase activity. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Farnesoid X-activated receptor (FXR) Target Info
NR1H4_HUMAN
References  Top
REF 1 microRNA-192 suppresses the expression of the farnesoid X receptor. Am J Physiol Gastrointest Liver Physiol. 2016 Jun 1;310(11):G1044-51.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.