Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T47510 Target Info
Target Name Angiomotin (AMOT)
Synonyms KIAA1071
Target Type Literature-reported Target
Gene Name AMOT
UniProt ID
Q4VCS5
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 PAR-CLIP [2]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
References  Top
REF 1 MicroRNA-497 inhibits cell proliferation, migration, and invasion by targeting AMOT in human osteosarcoma cells. Onco Targets Ther. 2016 Jan 18;9:303-13.
REF 2 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.