Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T45287 |
Target Info
|
Target Name |
Aspartyl aminopeptidase (DNPEP) |
Synonyms |
DAP; ASPEP |
Target Type |
Clinical trial Target |
Gene Name |
DNPEP |
Biochemical Class |
Peptidase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-140-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cagugguuuuacccuaugguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[1] |
2 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Adenosine deaminase (ADA)
|
Target Info
|
|
Aspartyl aminopeptidase (DNPEP)
|
Target Info
|
|
References |
Top |
REF 1 |
Chondrocyte-specific microRNA-140 regulates endochondral bone development and targets Dnpep to modulate bone morphogenetic protein signaling. Mol Cell Biol. 2011 Jul;31(14):3019-28.
|
REF 2 |
Profiling microRNA expression in murine bone healing and non-union formation: Role of miR-140 during the early stage of bone healing. PLoS One. 2019 Jul 19;14(7):e0218395.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.