Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T42724 Target Info
Target Name Calcium-activated potassium channel KCa3.1 (KCNN4)
Synonyms SKCa4; SKCa 4; SK4; Putative Gardos channel; KCa4; KCa3.1; Intermediate conductance calcium-activated potassium channel protein 4; IKCa1; IK1
Target Type Clinical trial Target
Gene Name KCNN4
Biochemical Class Voltage-gated ion channel
UniProt ID
O15554
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-497-5p miRNA Info
miRNA Mature AC
MIMAT0002820
Sequence cagcagcacacugugguuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-497-5p negatively regulated the gene expression of KCa3.1 by targeting KCa3.1 mRNA for cleavage. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Angiomotin (AMOT) Target Info
AMOT_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
References  Top
REF 1 miR-497-5p inhibits cell proliferation and invasion by targeting KCa3.1 in angiosarcoma. Oncotarget. 2016 Sep 6;7(36):58148-58161.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.