Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T41646 Target Info
Target Name Beta-arrestin-1 (ARRB1)
Synonyms Non-visual arrestin-2; Betaarrestin1; Arrestin beta1; Arrestin beta-1; ARR1
Target Type Literature-reported Target
Gene Name ARRB1
Biochemical Class Arrestin protein
UniProt ID
P49407
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-525-3p miRNA Info
miRNA Mature AC
MIMAT0002839
Sequence gaaggcgcuucccuuuagagcg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Beta-arrestin-1 (ARRB1) Target Info
ARRB1_HUMAN
References  Top
REF 1 Cell survival following radiation exposure requires miR-525-3p mediated suppression of ARRB1 and TXN1. PLoS One. 2013 Oct 16;8(10):e77484.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.