Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T40010 |
Target Info
|
| Target Name |
Epidermal growth factor-like protein 7 (EGFL7) |
| Synonyms |
ZNEU1; Vascular endothelial statin; VE-statin; UNQ187/PRO1449; NOTCH4-like protein; Multiple epidermal growth factor-like domains protein 7; Multiple epidermal growth factor-like domain protein 7; Multiple EGF-like domains protein 7; Multiple EGF-like domain protein 7; MEGF7; EGF-like protein 7 |
| Target Type |
Clinical trial Target |
| Gene Name |
EGFL7 |
| Biochemical Class |
Growth factor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-126-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucguaccgugaguaauaaugcg
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Overexpression of miR-126 in A549 cells increased EGFL7 expression. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Adrenomedullin (ADM)
|
Target Info
|
|
|
Angiopoietin 1 receptor (TEK)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-126 inhibits non-small cell lung cancer cells proliferation by targeting EGFL7. Biochem Biophys Res Commun. 2010 Jan 15;391(3):1483-9.
|
| REF 2 |
Endothelial-specific intron-derived miR-126 is down-regulated in human breast cancer and targets both VEGFA and PIK3R2. Mol Cell Biochem. 2011 May;351(1-2):157-64.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
