Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T38325 |
Target Info
|
| Target Name |
G0/G1 switch regulatory protein 8 (RGS2) |
| Synonyms |
Regulator of G-protein signaling 2; GIG31; G0S8; Cell growth-inhibiting gene 31 protein |
| Target Type |
Literature-reported Target |
| Gene Name |
RGS2 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-22-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aagcugccaguugaagaacugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The regulator of g protein signalling RGS2 was potentially repressed by miR-22. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
5-HT 2C receptor (HTR2C)
|
Target Info
|
|
|
ATP-citrate synthase (ACLY)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-4717-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaggccacagccacccaugugu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[3] |
| Representative Target(s) Regulated by This miRNA |
G0/G1 switch regulatory protein 8 (RGS2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-22 (miR-22) overexpression is neuroprotective via general anti-apoptotic effects and may also target specific Huntington's disease-related mechanisms. PLoS One. 2013;8(1):e54222.
|
| REF 2 |
Human microRNAs miR-22, miR-138-2, miR-148a, and miR-488 are associated with panic disorder and regulate several anxiety candidate genes and related pathways. Biol Psychiatry. 2011 Mar 15;69(6):526-33.
|
| REF 3 |
MicroRNA hsa-miR-4717-5p regulates RGS2 and may be a risk factor for anxiety-related traits. Am J Med Genet B Neuropsychiatr Genet. 2015 Jun;168B(4):296-306.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
