Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T35591 |
Target Info
|
| Target Name |
Nectin cell adhesion molecule 4 (NECTIN4) |
| Synonyms |
Poliovirus receptor-related protein 4; PVRL4; PRR4; Nectin-4; LNIR; Ig superfamily receptor LNIR |
| Target Type |
Successful Target |
| Gene Name |
NECTIN4 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-31-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugcuaugccaacauauugccau
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-31 binds to the 3'UTR of NECTIN4 and decrease NECTIN4 levels while anti-miR-31 increase NECTIN4 levels suggesting that NECTIN4 is miRNA targeted. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Nectin cell adhesion molecule 4 (NECTIN4)
|
Target Info
|
|
|
Transcription factor E2F2 (E2F2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-31 and miR-128 regulates poliovirus receptor-related 4 mediated measles virus infectivity in tumors. Mol Oncol. 2016 Nov;10(9):1387-1403.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
