Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T35040 Target Info
Target Name Basigin (BSG)
Synonyms UNQ6505/PRO21383; Tumor cell-derived collagenase stimulatory factor; TCSF; OK blood group antigen; Leukocyte activation antigen M6; Extracellular matrix metalloproteinase inducer; EMMPRIN; 5F7
Target Type Clinical trial Target
Gene Name BSG
Biochemical Class Basigin protein
UniProt ID
P35613
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism miR-22 was downregulated in HCC and inhibited HCC cell proliferation, migration and invasion through downregulating cancer-associated gene CD147 which may provide a new bio-target for HCC therapy. [2]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-492 miRNA Info
miRNA Mature AC
MIMAT0002812
Sequence aggaccugcgggacaagauucuu
miRNA Species Homo sapiens
Regulation Mechanism Transduction with pre-miR-492 in LS174T/L-OHP could inhibit gene promoter luciferase activities of CD147 30-UTR providing evidences that miR-492 could directly regulate the expression of CD147. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Basigin (BSG) Target Info
BASI_HUMAN
Multiple tumor suppressor 1 (CDKN2A) Target Info
CDN2A_HUMAN
miRNA Mature ID hsa-miR-22-5p miRNA Info
miRNA Mature AC
MIMAT0004495
Sequence aguucuucaguggcaagcuuua
miRNA Species Homo sapiens
Regulation Mechanism miR-22 regulates human tongue squamous cell carcinoma cell growth and motility by targeting CD147. [4]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Basigin (BSG) Target Info
BASI_HUMAN
References  Top
REF 1 The inhibition role of miR-22 in hepatocellular carcinoma cell migration and invasion via targeting CD147. Cancer Cell Int. 2017 Feb 2;17:17.
REF 2 A regulatory loop involving miR-22, Sp1, and c-Myc modulates CD147 expression in breast cancer invasion and metastasis. Cancer Res. 2014 Jul 15;74(14):3764-78.
REF 3 MiR-492 is functionally involved in Oxaliplatin resistance in colon cancer cells LS174T via its regulating the expression of CD147. Mol Cell Biochem. 2015 Jul;405(1-2):73-9.
REF 4 miR-22 regulates cell invasion, migration and proliferation in vitro through inhibiting CD147 expression in tongue squamous cell carcinoma. Arch Oral Biol. 2016 Jun;66:92-7.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.