Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T32348 | Target Info | |||
| Target Name | Early growth response protein 1 (EGR-1) | ||||
| Synonyms | Zinc finger protein Krox24; Zinc finger protein Krox-24; Zinc finger protein 225; ZNF225; Transcription factor Zif268; Transcription factor ETR103; Nerve growth factorinduced protein A; Nerve growth factor-induced protein A; NGFIA; NGFI-A; KROX24; AT225 | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | EGR1 | ||||
| Biochemical Class | EGR C2H2-type zinc-finger | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-183-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uauggcacugguagaauucacu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-183 regulates EGR1 levels through binding its 3'UTR. | [1] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay | [2] | |||
| Representative Target(s) Regulated by This miRNA | Dickkopf-related protein 3 (DKK3) | Target Info | |||
| Early growth response protein 1 (EGR-1) | Target Info | ||||
| miRNA Mature ID | hsa-miR-191-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | caacggaaucccaaaagcagcug | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-191 represses of the tumor-suppressor gene EGR1. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot | [3] | |||
| Representative Target(s) Regulated by This miRNA | CCAAT/enhancer binding protein beta (CEBPB) | Target Info | |||
| Cyclin-dependent kinase 6 (CDK6) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration. Cancer Res. 2010 Dec 1;70(23):9570-80. | ||||
| REF 2 | hsa-mir183/EGR1-mediated regulation of E2F1 is required for CML stem/progenitor cell survival. Blood. 2018 Apr 5;131(14):1532-1544. | ||||
| REF 3 | Estrogen mediated-activation of miR-191/425 cluster modulates tumorigenicity of breast cancer cells depending on estrogen receptor status. PLoS Genet. 2013;9(3):e1003311. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.