Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T31145 | Target Info | |||
| Target Name | Lysosome-associated membrane glycoprotein 1 (CD107a) | ||||
| Synonyms | Lysosomeassociated membrane protein 1; Lysosomeassociated membrane glycoprotein 1; Lysosome-associated membrane protein 1; LAMP-1; CD107 antigenlike family member A; CD107 antigen-like family member A | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | LAMP1 | ||||
| Biochemical Class | Lysosomal protein import | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-23a-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | aucacauugccagggauuucc | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis mediating surface antigen FAS (FAS) | Target Info | |||
| DNA topoisomerase I (TOP1) | Target Info | ||||
| miRNA Mature ID | hsa-miR-23a-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | gggguuccuggggaugggauuu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-23a in hypoxic TD-MVs operates as an additional immunomosuppressive factor, since it directly targets the expression of LAMP1 in NK cells. | [2] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | Gap junction alpha-1 protein (GJA1) | Target Info | |||
| Lysosome-associated membrane glycoprotein 1 (CD107a) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | The TGF--inducible miR-23a cluster attenuates IFN- levels and antigen-specific cytotoxicity in human CD8 T cells. J Leukoc Biol. 2014 Oct;96(4):633-45. | ||||
| REF 2 | Hypoxic tumor-derived microvesicles negatively regulate NK cell function by a mechanism involving TGF- and miR23a transfer. Oncoimmunology. 2015 Jun 24;5(4):e1062968. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.