Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T30829 |
Target Info
|
| Target Name |
NIMA-related kinase 6 (NEK6) |
| Synonyms |
Serine/threonine-protein kinase Nek6; Protein kinase SID6-1512; NimA-related protein kinase 6; Never in mitosis A-related kinase 6 |
| Target Type |
Literature-reported Target |
| Gene Name |
NEK6 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-23a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aucacauugccagggauuucc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-23a associates to the 3' untranslational region (3' UTR) of NEK6, whose overexpression was reported to negatively regulate the activity of p53 in human cancers. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
DNA topoisomerase I (TOP1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Berberine-induced tumor suppressor p53 up-regulation gets involved in the regulatory network of MIR-23a in hepatocellular carcinoma. Biochim Biophys Acta. 2014 Sep;1839(9):849-57.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
