Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T29339 Target Info
Target Name Retinoic acid-inducible gene-1 (RIG-1)
Synonyms Retinoic acidinducible gene I protein; Retinoic acidinducible gene 1 protein; Retinoic acid-inducible gene I protein; Retinoic acid-inducible gene 1 protein; RLR1; RLR-1; RIGIlike receptor 1; RIGI; RIG1; RIG-I-like receptor 1; RIG-I; Probable ATPdependent RNA helicase DDX58; Probable ATP-dependent RNA helicase DDX58; DEAD box protein 58
Target Type Clinical trial Target
Gene Name DDX58
Biochemical Class Acid anhydride hydrolase
UniProt ID
O95786
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
References  Top
REF 1 Reduction of TIP30 in esophageal squamous cell carcinoma cells involves promoter methylation and microRNA-10b. Biochem Biophys Res Commun. 2014 Oct 31;453(4):772-7.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.