Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T25847 Target Info
Target Name Rotamase B (PPIB)
Synonyms SCYLP; S-cyclophilin; Peptidyl-prolyl cis-trans isomerase B; PPIase B; Cyclophilin B; CYPB; CYP-S1
Target Type Successful Target
Gene Name PPIB
Biochemical Class Cis-trans-isomerase
UniProt ID
P23284
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-520d-5p miRNA Info
miRNA Mature AC
MIMAT0002855
Sequence cuacaaagggaagcccuuuc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Rotamase B (PPIB) Target Info
PPIB_HUMAN
References  Top
REF 1 Gastric Cancer Cell Proliferation and Survival Is Enabled by a Cyclophilin B/STAT3/miR-520d-5p Signaling Feedback Loop. Cancer Res. 2017 Mar 1;77(5):1227-1240.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.