Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T25703 |
Target Info
|
| Target Name |
Heme oxygenase 1 (HMOX1) |
| Synonyms |
HO1; HO-1; HO |
| Target Type |
Clinical trial Target |
| Gene Name |
HMOX1 |
| Biochemical Class |
Paired donor oxygen oxidoreductase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-122-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggagugugacaaugguguuug
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Microarray |
[1] |
| 2 |
Western Blot; qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
|
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
|
| REF 2 |
miR-122-induced down-regulation of HO-1 negatively affects miR-122-mediated suppression of HBV. Biochem Biophys Res Commun. 2010 Aug 6;398(4):771-7.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
