Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T24609 Target Info
Target Name Polypyrimidine tract-binding protein (PTBP1)
Synonyms hnRNP I; Polypyrimidine tractbinding protein 1; Polypyrimidine tract-binding protein 1; PTB; Heterogeneous nuclear ribonucleoprotein I; 57 kDa RNAbinding protein PPTB1; 57 kDa RNA-binding protein PPTB-1
Target Type Literature-reported Target
Gene Name PTBP1
UniProt ID
P26599
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism Luciferase reporter activity of wild-type pMIR-PTBP1 was significantly inhibited after the introduction of miR-133b. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Regulation Mechanism Constructs with intact miRNA binding sites of PTB1 were expressed at significantly lower levels of luciferase activity in the presence of miR-340. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
References  Top
REF 1 MiR-133b inhibits growth of human gastric cancer cells by silencing pyruvate kinase muscle-splicer polypyrimidine tract-binding protein 1. Cancer Sci. 2016 Dec;107(12):1767-1775.
REF 2 PTBP1-associated microRNA-1 and -133b suppress the Warburg effect in colorectal tumors. Oncotarget. 2016 Apr 5;7(14):18940-52.
REF 3 miR-124, miR-137 and miR-340 regulate colorectal cancer growth via inhibition of the Warburg effect. Oncol Rep. 2012 Oct;28(4):1346-52.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.